fastq2bcl convert fastq files in a bcl2fastq-able run directory
Project description
fastq2bcl
fastq2bcl convert fastq files in a bcl2fastq-able run directory.
A FASTQ file is a text file that contains the sequence data from the clusters that pass filter on a flow cell.
Illumina sequencing instruments generate per-cycle BCL basecall files as primary sequencing output, but many downstream analysis applications use per-read FASTQ files as input.
bcl2fastq combines these per-cycle BCL files from a run and translates them into FASTQ files.
At the same time as converting, bcl2fastq also separates multiplexed samples (demultiplexing). Multiplexed sequencing allows you to run multiple individual samples in one lane. The samples are identified by index sequences that were attached to the template during sample prep. The multiplexed sample FASTQ files are assigned to projects and samples based on a user-generated sample sheet, and stored in corresponding project and sample directories
FASTQ sample sequence:
@M11111:222:000000000-K9H97:1:1101:21270:1316 1:N:0:1 CTTCCTAGAAGTACGTGCCAGCACGATCCAATCTCGCATCACCTTTTTTCTTTCTACTTCTACTCTCCTCTTATCTCTTCTTTTTCTTGTTTTTTTTCTTTATTCCATCT + CCCCCFA,,,,C9C6E-:C9,C,C+,:EC9,CFDE,@+6+;,,,C,CF7,@9E,,,C<,,,;<C,,6,,:C@,,,,:<<@,,,5=A,<,,,4,9=:@<?,,,,9C,,9,,
Structure of an illumina run directory:
YYMMDD_M11111_0222_000000000-K9H97 ├── Data │ └── Intensities │ ├── BaseCalls │ │ └── L001 │ │ ├── C1.1 │ │ │ ├── s_1_1101.bcl │ │ │ └── s_1_1101.stats │ │ ├── CNN.1 │ │ │ ├── s_1_1101.bcl │ │ │ └── s_1_1101.stats │ │ ├── s_1_1101.control │ │ └── s_1_1101.filter │ └── L001 │ └── s_1_1101.locs └── RunInfo.xml
fastq2bcl take as input a set of reads (fastq.gz files) and generates a flow cell directory with:
RunInfo.xml
bcl and stat for each cycle
filter file
control file
location file
See also: Illumina specs
Usage
Help:
usage: fastq2bcl [-h] [--version] [-v] [-vv] [-m MASK] -r1 R1 [-r2 R2] [-i1 I1] [-i2 I2] [-o OUTDIR] [--exclude-umi] [--exclude-index] Convert fastq.gz reads and metadata in a bcl2fastq-able run directory options: -h, --help show this help message and exit --version show program's version number and exit -v, --verbose set loglevel to INFO -vv, --very-verbose set loglevel to DEBUG -m MASK, --mask MASK define mask in format 110N10Y10Y110N -r1 R1, --read-1 R1 fastq.gz with R1 reads -r2 R2, --read-2 R2 fastq.gz with R2 reads (optional) -i1 I1, --index-1 I1 fastq.gz with I1 reads (optional) -i2 I2, --index-2 I2 fastq.gz with I2 reads (optional) -o OUTDIR, --outdir OUTDIR Set the output directory for mocked run. default: cwd --exclude-umi Do not write UMI from the R1 and R2 fastq reads to the cycles --exclude-index Do not write Index from the R1 and R2 fastq reads to the cycles
Usage examples:
fastq2bcl -r1 single.fastq.gz fastq2bcl -r1 R1.fastq.gz -r2 R2.fastq.gz -i1 I1.fastq.gz -i2 I2.fastq.gz fastq2bcl -o output_dir -r1 single.fastq.gz fastq2bcl -o output_dir --exclude-index -r1 single.fastq.gz fastq2bcl -o output_dir -m 100Y20N -r1 R1.fastq.gz -r2 R2.fastq.gz -i1 I1.fastq.gz -i2 I2.fastq.gz
Custom mask
By default fastq2bcl will generate a RunInfo.xml file where Reads entries are generated using the sequence length of fastq.gz files.
For exammple, if I give as input 2 pairs with length 300 bp and 2 indexes with length 8p the resulting RunInfo will be:
<?xml version="1.0"?> <RunInfo xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" Version="2"> <Run Id="YYMMDD_run_0001_ABCD" Number="1"> <Flowcell>ABCD</Flowcell> <Instrument>run</Instrument> <Date>YYMMDD</Date> <Reads> <Read c="300" Number="1" IsIndexedRead="N" /> <Read NumCycles="8" Number="2" IsIndexedRead="Y" /> <Read NumCycles="8" Number="3" IsIndexedRead="Y" /> <Read NumCycles="300" Number="4" IsIndexedRead="N" /> </Reads> <FlowcellLayout LaneCount="1" SurfaceCount="1" SwathCount="1" TileCount="1" /> </Run> </RunInfo>
You can provide a custom mask (string). For example for 1 pair 350 bp with 1 index of 8bp:
350N8Y
Install
use pip to install in edit mode:
pip install -e .
Install packages for dev in a mamba environment:
mamba create -n fastq2bcl mamba install -n fastq2bcl -c conda-forge tox pyscaffold biopython pytest-cov
Scripts
In the directory scripts there are some useful tools:
scripts/bcl2fastq_docker.sh run bcl2fastq with docker on the current directory. Run it inside a run directory.
scripts/build_flowcells.sh generate all the test flowcells using the datasets in data/test directory
Test
use tox or pytest to test:
tox pytest
To test with pytest you need also pytest-cov in your environment.
Lint
you can lint code with:
tox -e lint
Pre commit hook is already configured and can be installed with this command:
pre-commit install
Fastq sequence description
Fields in fastq description:
Key |
Description |
---|---|
instrument |
Instrument ID |
run_number |
Run number on instrument. |
flowcell_ids |
Flowcell Identifier |
flowcell_ids |
Flowcell IDS |
lane |
Lane number |
tile |
Tile number |
x_pos |
Position X of cluster |
y_pos |
Position Y of cluster |
UMI |
Optional, appears when UMI is specified in sample sheet. UMI sequences for Read 1 and Read 2, seperated by a plus [+] |
read |
Read number - 1 can be single read or Read 2 of paired-end |
is_filtered |
Y if the read is filtered (did not pass), N otherwise |
control_number |
0 when none of the control bits are on, otherwise it is an even number. On HiSeq X and NextSeq systems, control specification is not performed and this number is always 0. |
index |
Index of the read |
Filter file
The filter files can be found in the BaseCalls directory. The filter file specifies whether a cluster passed filters. Filter files are generated at cycle 26 using 25 cycles of data. For each tile, one filter file is generated. Location: Data/Intensities/BaseCalls/L001 File format: s_[lane]_[tile].filter
The format is described below
Bytes |
Description |
---|---|
0-3 |
Zero value (for backwards compatibility) |
4-7 |
Filter format version number |
8-11 |
Number of clusters |
12-(N+11) |
Where N is the cluster number. unsigned 8-bits integer Bit 0 is pass or failed filter |
Filter bytes example:
bytes([0, 0, 0, 0]) # prefix 0 bytes([3, 0, 0, 0]) # version 3 struct.pack("<I", cluster_count) # number of cluster in little endian unsigned int bytes([1]*cluster_count) # For each cluster an unsigned 8-bits integer Where Bit 0 is pass or failed filter 1 == PASS FILTER 0 == NO PASS FILTER
In hexdump:
BYTES 0-3 BYTES 4-7 BYTES 8-11 BYTES 12-14 00 00 00 00 03 00 00 00 03 00 00 00 01 01 01
At bytes 8-11 I have 3 clusters and each cluster is represented by a an unsigned 8-bit integer.
Control file
The control files are binary files containing control results.
Bytes |
Description |
---|---|
0-3 |
Zero value (for backwards compatibility) |
4-7 |
Format version number |
12-(2xN+11) |
|
Locations file
The BCL to FASTQ converter can use different types of position files and will expect a type based on the version of RTA used The locs files can be found in the Intensities/L<lane> directories
Bcl file
The BCL files can be found in the BaseCalls directory inside the run directory: Data/Intensities/BaseCalls/L<lane>/C<cycle>.1
They are named as follows:
s_<lane>_<tile>.bcl
Format:
Bytes |
Description |
---|---|
0-3 |
Number of N clusters in unsigned 32bits little endian integer |
4-(N+3) |
|
Stat file
The stats files can be found in the BaseCalls directory inside the run directory: Data/Intensities/BaseCalls/L00<lane>/C<cycle>.1
They are named as follows:
s_<lane>_<tile>.stats
The Stats file is a binary file containing base calling statistics; the content is described below.
The data is for clusters passing filter only:
Start |
Description |
Data type |
---|---|---|
Byte 0 |
Cycle number |
integer |
Byte 4 |
Rverage Cycle Intensity |
double |
Byte 12 |
Average intensity for A over all clusters with intensity for A |
double |
Byte 20 |
Average intensity for C over all clusters with intensity for C |
double |
Byte 28 |
Average intensity for G over all clusters with intensity for G |
double |
Byte 44 |
Average intensity for A over clusters with base call A |
double |
Byte 52 |
Average intensity for C over clusters with base call C |
double |
Byte 60 |
Average intensity for G over clusters with base call G |
double |
Byte 68 |
Average intensity for T over clusters with base call T |
double |
Byte 76 |
Number of clusters with base call A |
integer |
Byte 80 |
Number of clusters with base call C |
integer |
Byte 84 |
Number of clusters with base call G |
integer |
Byte 88 |
Number of clusters with base call T |
integer |
Byte 92 |
Number of clusters with base call X |
integer |
Byte 96 |
Number of clusters with intensity for A |
integer |
Byte 100 |
Number of clusters with intensity for C |
integer |
Byte 104 |
Number of clusters with intensity for G |
integer |
Byte 108 |
Number of clusters with intensity for T |
integer |
References
bcl2fastq source code from illumina downloads https://support.illumina.com/sequencing/sequencing_software/bcl2fastq-conversion-software/downloads.html
Spec file from illumina support https://support.illumina.com/content/dam/illumina-support/documents/documentation/software_documentation/bcl2fastq/bcl2fastq_letterbooklet_15038058brpmi.pdf
https://docs.python.org/3/library/struct.html#format-characters
See also mkdata.sh file in bcl2fastq source code for insights on bcl format.
Acknowledgments
Notes
This project is inspired by the test script https://github.com/ShawHahnLab/igseq/blob/dev/tools/fastq2bcl.py from https://github.com/ShawHahnLab
This project has been set up using PyScaffold 4.5. For details and usage information on PyScaffold see https://pyscaffold.org/.
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.